Using a gRNA (targeting GTCTGGTCCTGCGTTGGCCA) and an ssODN template (TGCCCTTCATGCTCTTCTCTCTCCTTATGTCCCCAGGGGCTGGGATTCTCACGATGGCCAACGCAGGACCAGACACCAATGGCAGCCAGTTCTTTGTGACC) with CRISPR/Cas9 technology, two point mutations were engineered to change alanine codon 99 (GCC) to a threonine codon (ACG) (p.A99T). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. (J:300487)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count