Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to aspartic acid codon GAT (p.S533D). This mutation creates a phosphomimetic residue at this position. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count