Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to alanine codon GCA (p.S533A). This mutation renders the encoded peptide nonphosphorylatable at this residue. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count