A 1 bp insertion (or duplication of a T) was created using an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) with CRISPR/Cas9 technology. The resulting frameshift leads to a premature stop codon. Western blot experiments confirmed the lack of peptide expression from this allele. (J:294930)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count