Exon 10 was targeted with an sgRNA (targeting CCATCCGGGAACTCATTCCAAGA) using CRISPR/Cas9 technology, resulting in a 2 bp deletion of CG. Exon 10 contains mutations in human patients presenting with a phenotype similar to, but distinct from, cranio-cerebello-cardiac/Ritscher-Schinzel syndrome (3C/RSS). (J:301722)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count