LoxP sites were inserted upstream of exon 1 and into intron 3 using two gRNAs (targeting TGAACTGCAGCAGCGTTCCT and AGATATTATTAGAGTAGCCG) and two ssODN templates with CRISPR/Cas9 technology, creating a conditional-ready allele with exons 1-3 floxed. (J:302140)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count