Guide RNA (CTTGGTGGCAGTGTGCATAG) is designed to create a guanine to adenine missense mutation resulting in a valine to methionine change (V1613M) in the gene. This mutation (SNP rs117187003) is homologous to the human V1599M SNP which has been associated with increased risk of sporadic Alzheimer's disease. Two silent DNA mutations were also introduced just upstream of the mutation. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count