Exon 1 was targeted with an sgRNA (targeting TGAAACCAGCAAGAAGAACG) and an ssODN template, containing a A-to-T mutation (T-to-A on forward strand) in lysine codon 53, using CRISPR/Cas9 technology. The resulting mutation causes premature translation termination (p.K53*). (J:301313)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count