The 5' end of exon 4 was targeted with sgRNAs (targeting ATTTCCTTACTCCCTCAGCG and GGATAGTAACTGGACAGGTA) using CRISPR/Cas9 technology, resulting in a 59 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf2em1Jhha and Ythdf3em1Jhha alleles in the same ESC line. (J:299108)
Basic Information
(C57BL/6 x 129S4/SvJae)F1
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count