A 2 bp insertion (GC or CG) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a large net positive charge on the normally negatively charged tail of the encoded peptide. (J:298827)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count