This allele is derived from the Stra8em1Keish allele, which was generated as follows: sequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs targeting GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. Subsequent CRISPR/Cas9 targeting with a crRNA (targeting ACAGATCGTCAAAGGTCTCC(agg) in exon 9) and tracrRNA resulted in a 2 bp (GA) deletion and 1 bp insertion (C). (J:290712)
Basic Information
(C57BL/6J x 129S6/SvEvTac)F1
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count