Exons 3 and 4 were targeted with sgRNAs (GATCACTAATACGACTCACTATAGGCTCCGGACAAAGAATAACGTTTTAGCTAGAAAT and GATCACTAATACGACTCACTATAGGCATCGGCGATGTCGGTGCGTTTTAGAGCTAGAAAT) using CRISPR/Cas9 technology, resulting in a 274 bp deletion (including a 122 bp deletion of the entire exon 3 and a 35 bp deletion of the 5' end of exon 4). RT-PCR experiments confirm lack of expression from this allele. (J:293535)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count