Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) are designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H). This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count