This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. (J:282593)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count