CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon of the variant coding region (immediately before the stop codon.TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rorc exon: CTGCCACCCAAAGGAAAACTCCGGAGCCTGTGCAGCCAACATGTGGAAAAGCTGCAGATCTTCCAGCACCTCCACCCCATCGTGGTCCAAGCCGCCTTCCCTCCACTCTATAAGGAACTCTTCAGCACTGATGTTGAATCCCCTGAGGGGCTGTCAAAG] ggaggcggatcgggaggcggatcgggcggatcggca TGGTCGCATCCGCAGTTTGAAAAA ggaggcggatcgggaggcggatcgggcgga TCCGCT TGGTCGCATCCGCAGTTTGAAAAG [TGA stop]. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count