CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon immediately before the stop codon. TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rora exon: CGGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAATTGTTCACTTCAGAATTTGAGCCAGCTATGCAGATTGACGGA] gcaagcggatcggcttcaggatcggcctct TGGTCTCACCCACAGTTCGAGAAG ggaggcggatccggaggtgggtctggcggatccgct TGGTCCCATCCTCAGTTTGAAAAG [TAA stop]. (J:336987)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count