This allele from project TCPR1564 was generated at The Centre for Phenogenomics by electroporatingCas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TATGCATGTGAGTCGATTTT targeting the 5' side and GTTTCTCTAATTGCTAGCCC targeting the 3' side of a critical region. This resulted in a 934-bp deletion Chr5:52171035-52171968_insGAG (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count