This allele from project TCPR1577 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTATCTCACGTTAGCCGCA targeting the 5' side and CTCTCCTGTGTGCGTACAGA targeting the 3' side of a critical region. This resulted in a 593-bp deletion Chr11:87729778-87730370 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count