Mecp2^em7.1Bird

CRIPSPR-targeting replaced the sequence encoding the methyl-CpG binding domain (MBD) of Mecp2 (NCBI NM_010788 c. 280-492 and intron 3; p. 94-164) with the homologous sequence from MBD2 (NCBI NM_010773 c. 457-651, excluding the intron; p. 153-217). The gene was tagged at the C-terminus by EGFP connected with a short linker (TGTAAGGATCCACCGGTCGCCACC). Cre-mediated recombination removed the selection cassette in intron 2. (J:309631)