This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGCTACATTCCCATTTAA and ATGGCGGGATGCCATGGAGG, which resulted in a 6557 bp deletion beginning at Chromosome 19 position 11,548,405 bp and ending after 11,554,961 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000991798, ENSMUSE00000985830, ENSMUSE00001086305, ENSMUSE00000144349 (exons 2,3,4,5) and 6097 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. There is a 3 bp deletion (ATT) 24 bp before the larger deletion. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count