Actr3b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATAATGACAGCATGAGTG and ACTCTGAGCATTGCTATGGG, which resulted in a 268 bp deletion beginning at Chromosome 5 position 25,798,387 bp and ending after 25,798,654 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000551024 (exon 2) and 212 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 9 amino acids later. (J:188991)