Tram1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCAGGGTTTCCACAGGGG and TCTCCCAAATGAACGCACCA, which resulted in a 340 bp deletion beginning at Chromosome 1 position 13,580,800 bp and ending after 13,581,139 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000387757 (exon 2) and 276 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 25 amino acids later. (J:188991)