Cfap58^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAAGACCCCCCAAACAAA and TCATGAGCCCATTTTGCCCA, which resulted in a 350 bp deletion beginning at Chromosome 19 position 47,948,074 bp and ending after 47,948,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000617882 (exon 4) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 66 amino acids later. (J:188991)