This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGAGAGGAAGCAGCGCT and CATTGCCGCCAGACCCTACG, which resulted in a 917 bp deletion beginning at Chromosome 10 position 80,547,705 bp and ending after 80,548,621 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237652 and ENSMUSE00001289454 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 632 and early truncation 24 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count