Acyp1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTAATTCGTTATTGTGAG and GTGAGACTGCACGGAACAAA, which resulted in a 551 bp deletion beginning at Chromosome 12 position 85,272,332 bp and ending after 85,272,882 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000715783 (exon 3) and 121 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 10 amino acids later. (J:188991)