This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATACGCAGAGTATCCCA and GATTGTTGCAGCACATCGCA, which resulted in a 5299 bp deletion beginning at Chromosome 9 position 114,758,536 bp and ending after 114,763,834 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001047288, ENSMUSE00000219733 and ENSMUSE00001092044 (exons 2,3 and 4) and 4944 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 78 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count