This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAATGTAATCTCAAATGT and ATAATATGTACAGGTTGTGT, which resulted in a 6990 bp deletion beginning at Chromosome 9 position 114,789,313 bp and ending after 114,796,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000329345, ENSMUSE00000329328 and ENSMUSE00000359329 (exons 2,3 and 4) and 6298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 58 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count