Exon 1 and intron 1 were targeted with sgRNAs (targeting CCAGAAGCCGAGGCGACCGCGGG and TCTCCGGAGTCCGCGCCCTAAGG) using CRISPR/Cas9 technology, resulting in a 174 bp deletion which includes the start of the CDS at the 3' end of exon 1. (J:82809, J:282407)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count