Exon 1 and the exon1-intron 1 boundary were targeted with sgRNAs (targeting TATGGGAACTTTGCTGTCGGTGG and GACCTGGACATTCGGTGAGGAGG) using CRISPR/Cas9 technology, resulting in a 227 bp deletion encompassing the 3' part of the CDS in exon 1. (J:82809)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count