Ankrd44^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGATGGCTGTATCGCGGT and TTCCTGATCTGGGAGTCGGG, which resulted in a 286 bp deletion beginning at Chromosome 1 position 54,763,622 bp and ending after 54,763,907 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001210942 (exon 7) and 143 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 1 amino acids later. There is a single base pair insertion (T) at the deletion site. (J:188991)