Tifab^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCCTTGGGTCTGTAAATC and GAGCCTGTACCACCCTACAC, which resulted in a 368 bp deletion beginning at Chromosome 13 position 56,176,215 bp and ending after 56,176,582 bp (GRCm38/mm10). This mutation deletes 368 bp from ENSMUSE00001037023 (exon 3) and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 17 amino acids later. There is a 4 bp insertion (GGCT) at the deletion site. (J:188991)