H2az1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCAATGGGAGAACGCACAG and GTACTTTCGTTGTACCCTGA, which resulted in a 2664 bp deletion beginning at Chromosome 3 position 137,864,450 bp and ending after 137,867,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669244, ENSMUSE00001255094, ENSMUSE00001280001, ENSMUSE00001260075, ENSMUSE00000635681 (exons 1-5) and 1575 bp of flanking intronic sequence including the splice acceptor, donor and start site. This deletion is predicted to generate a null allele. (J:188991)