This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTTCGACAGTTTTGTGG and GCGTTTTGTACGATAGTGGA, which resulted in a 611 bp deletion beginning at Chromosome 5 position 115,237,751 bp and ending after 115,238,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519136, ENSMUSE00000465080 (exons 2 and 3) and 222 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count