Brcc3dc^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAAGACAGCTCTTCCATA and GATGGCGGTGCGGATGATGC, which resulted in a 846 bp deletion beginning at Chromosome 10 position 108,699,232 bp and ending after 108,700,077 bp (GRCm38/mm10). This mutation deletes 846 bp from ENSMUSE00001410224 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 remove 282 amino acids, return to frame for the last 4 amino acids before the stop. (J:188991)