This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCACTCACCCCAAGTAT and GGTGTAAGATTTGGGAGCAG, which resulted in a 423 bp deletion beginning at Chromosome 14 position 14,348,720 bp and ending after 14,349,142 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000565028 (exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 19 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count