This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTCTCAAAGCCCATGAGC and ACTGAAGATTCCTTCGACGA, which resulted in a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10). This mutation deletes 108 bp from ENSMUSE00000972866 (exon 2) and is predicted to cause a loss of 36 amino acids after residue 26 and remain in frame for the expected termination. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count