This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCTGAACCTGCCTGCCA and AGCATTGTCCAAGGTTCGAA, which resulted in a 607 bp deletion beginning at Chromosome 12 position 86,988,132 bp and ending after 86,988,738 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001414833 (exon 2) and 67 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count