This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTTACAGGGTTTCGCCTCGGTT, TTGCCTTGGGGGAGACGGGCAGG, which resulted in a Exon Deletion. Sanger sequencing verified a 1113 bp deletion including exon 1 of Gm15551 (3:126462197-126463309, GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count