Arginine codon 591 (CGT) was targeted for change to a tryptophan codon (TGG)(p.R591W) with sgRNAs (targeting GCTGTGTCAGCTCCTGACGGAGG and GGAAGCTGCCAGCCTCCGTCAGG) and an ssODN template (CAGCAGTTGGAGGCAGCACGTCGGGGCCAGCAGGAGAGCACGGAGGAAGCTGCCAGCCTCtGgCAGGAGCTGACACAGCAGCAGGAAATCTACGGGCAAGGTGTGGGGGCGTGGCGGTGTGTG) using CRISPR/CAS9 technology. This mutation mimics the human p.R587W variant associated with susceptibility to alopecia areata. (J:309941)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count