Unkl^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGCAGTTATAGCCCGA and AATGGCTCACGGTTAGCAGT, which resulted in a 299 bp deletion beginning at Chromosome 17 position 25,201,004 bp and ending after 25,201,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001293958 (exon 4) and 165 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 1 amino acids later. (J:188991)