Dmtf1l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACTGTGGTCCAGTGGGCA and GAGCTCTGTCTTACTTAGTG, which resulted in a 1381 bp deletion beginning at Chromosome X position 126,814,082 bp and ending after 126,815,466 bp (GRCm38/mm10). This mutation deletes 1381 bp of ENSMUSE00001029817 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. There is a 4 bp insertion (ACCA) at the deletion site. (J:188991)