Dnaaf3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAACCCTAGGCCACAGTAG and TCTCTGAAAAATCTTGCCCA, which resulted in a 617 bp deletion beginning at Chromosome 7 position 4,527,750 bp and ending after 4,528,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000419696 (exon 5) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 21 amino acids later. (J:188991)