Wdr91^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATCATGATAACGGAGTCCA and CTAGGAAGCTCCCTCAACAG, which resulted in a 329 bp deletion beginning at Chromosome 6 position 34,905,345 bp and ending after 34,905,673 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001222960 (exon 5) and 195 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 198 and early truncation 27 amino acids later. (J:188991)