This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGATTGCCAACTACACA and TCTTCTGCCAGGAGAGATTG, which resulted in a 2700 bp deletion beginning at Chromosome 1 position 133,656,861 bp and ending after 133,659,560 bp (GRCm38/mm10). This mutation deletes 2700 bp from ENSMUSE00001073319 (exon 1) and is predicted to cause a change of amino acid sequence after residue 12, deletion of 901 amino acids and a return to frame for the last 67 amino acids and expected termination. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count