This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAAGAGCGCAGAGACTATT and TCTCAAGATGCTTGTAGCCC, which resulted in a 1112 bp deletion beginning at Chromosome 17 position 5,417,539 bp and ending after 5,418,650 bp (GRCm38/mm10). This mutation deletes 1112 bp of ENSMUSE00001326799 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 7 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count