Four oligo nucleotide guides RNAs (ACAAAATCTACCCTCTAGTA, GTCAGACACTGCCGTACTAG, TAAAGTTGTAGATAGACACT and AGACACTGGGACAAGCTTGG) were designed to introduce a large frameshift deletion mutation spanning exon 1/intron 1 of the gene using CRISPR/Cas9 genome editing. DNA sequencing of the offspring identified the allele to be a 897 nt frameshift deletion that begins 103 nt 3' of the ATG translation start codon in exon 1 and extends 100 nt into intron 1. (J:101977)
Basic Information
NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count