This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAACTAAGATTTCGACC and AGTCACTCTAGGATGAGTGG, which resulted in a 3508 bp deletion beginning at Chromosome 1 position 119,907,771 bp and ending after 119,911,278 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000391040 (exon 2) and 243 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count