Ssh2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGAGATGCTGGCTTAAAG and TTAAAATTCAAGATAAAGTA, which resulted in a 341 bp deletion beginning at Chromosome 11 position 77,408,044 bp and ending after 77,408,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280145 (exon 5) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation. (J:188991)