This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAAAAGGATTTATAACCG and GTATTTTTCTAGCTTCATAA, which resulted in a 1239 bp deletion beginning at Chromosome 10 position 24,076,376 bp and ending after 24,077,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001051733 (exon 1) and 204 bp of flanking intronic sequence including the splice acceptor, donor and start site. This mutation is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count