CRISPR/Cas9 technology using gRNA 5' ACGCCACTTCAGGTCTACCA 3' introduced a G to A change at position 193 and an A to G change at position 195 resulting in a valine to methionine substitution at amino acid 65 (V65M). This corresponds to the human V65M mutation associated with Cantu Syndrome. (J:281903)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count